The short version of Reverse-phase HPLC fits in a sentence. The long version — which is the one that helps — is below.
This page was last updated on 2026-05-21 and is reviewed periodically as new material appears.
TB-500 refers to a synthetic peptide fragment derived from the actin-binding region of thymosin beta-4, a protein present in most mammalian cells. The full protein contains forty-three amino acids, while the commonly sold fragment is a much shorter acetylated sequence, often cited as LKKTETQ. The fragment retains part of the actin-binding motif but lacks the remainder of the parent protein. Material sold under this name is usually lyophilized powder intended for laboratory research, and it is not a finished pharmaceutical product.
Proposed activity centers on actin sequestration and on the movement of cells during repair processes. In cell culture and animal models, the fragment has been associated with migration, tube formation, and tissue remodeling. These observations are frequently described as preliminary, because most published work uses rodent or in vitro systems rather than controlled human trials. Whether the short fragment reproduces the effects of the full protein remains an open question, and the relationship between dose, route, and measured outcome is not well characterized.
The compound circulates in the literature as a research reagent rather than an approved therapeutic. Regulatory agencies in several countries have not authorized it for medical use, and sporting bodies list related thymosin beta-4 peptides among prohibited substances. Suppliers typically market it with a purity figure and a certificate of analysis, while peer-reviewed clinical reports remain sparse. Discussions therefore often separate laboratory findings from anecdotal reports, and reviewers tend to note the small size and methodological limits of the available studies.
Full-length thymosin beta-4 consists of roughly forty-three amino acids and ranks among the more abundant small proteins in the cytoplasm. The fragment is much shorter, so it cannot reproduce every function attributed to the intact molecule. In cell culture, short actin-binding motifs can interfere with filament dynamics and cell movement, but such observations come from controlled experiments rather than from whole-animal work. Whether a truncated fragment produces the same effects as the parent protein remains an open question.
Interest in the peptide grew during the 2000s and 2010s, when studies of tendon and ligament injuries in horses reported changes in lesion size after treatment. Those reports circulated widely outside the scientific literature and shaped much of the current online discussion. Subsequent reviews noted inconsistent study design, small groups, and a shortage of independent replication. Popular descriptions often blur the line between the fragment, the complete protein, and unrelated growth factors, which complicates comparisons across sources.
| Property | Value | Notes |
|---|---|---|
| Appearance | White to off-white powder | Lyophilized solid as supplied |
| Water solubility | Soluble | Dissolves in aqueous media |
| Typical storage temperature | -20 °C | Dry powder, desiccated, protected from light |
| Typical analytical method | RP-HPLC with mass spectrometry | Purity from peak area; mass for identity |
| Common synonyms | Tβ4 fragment; thymosin beta-4 fragment | Naming varies by supplier and catalogue |
The regulatory position is broadly consistent across major jurisdictions: no thymosin beta-4 fragment is an approved medicine, and laboratory material is commonly labelled as not intended for human consumption. Anti-doping rules in sport list thymosin beta-4 and its fragments among prohibited peptide hormones. Because these products travel through research-chemical channels rather than pharmaceutical supply chains, quality varies considerably between vendors. Independent testing of identity, purity and sterility is the only dependable check, and a certificate of analysis describes one batch rather than a supplier's whole catalogue.
Lyophilized peptide powder is normally held desiccated at −20 °C, with −80 °C used for longer storage periods. Allowing a sealed vial to reach room temperature before opening is standard practice, because condensation forming on cold powder introduces moisture. Once dissolved, solutions are typically kept cold and shielded from light. Repeated freeze-thaw cycles are avoided because they encourage aggregation and gradual loss of material. These conventions are general to synthetic peptides rather than unique to any one sequence.
Purity and identity are separate measurements and are often confused. Reverse-phase high-performance liquid chromatography, usually with ultraviolet detection near 214 nanometres, reports the share of total peak area belonging to the target compound. Mass spectrometry by electrospray or matrix-assisted laser desorption then checks whether the observed mass matches the expected sequence. Neither measurement alone shows that a vial holds the intended peptide. Peptide content, meaning the fraction of vial mass that is genuine peptide rather than counter-ion, water or residual acid, is reported separately and is frequently lower than the stated purity figure.
Identity and purity are normally assessed with reversed-phase high-performance liquid chromatography, paired with mass spectrometry to confirm molecular mass. A certificate of analysis reports a purity percentage, usually derived from chromatographic peak area, but that figure does not by itself prove a correct sequence or the absence of counterions. Independent verification may include amino acid analysis or peptide mapping. Batch-to-batch variation is a documented concern in the research chemical market, and the gap between a quoted purity value and actual peptide content can be substantial when the material is a salt or retains residual water.
Lyophilized peptide arrives as a dry cake that should stay sealed until use. Reconstitution is generally performed with sterile water or a buffered solution, and the resulting liquid should be handled gently to limit mechanical stress. Repeated freeze-thaw cycles are widely described as harmful to short peptides, so dividing a reconstituted batch into single-use portions is a common practice. Laboratories also record the solvent, concentration, and date of preparation on the vial label to keep later measurements traceable.
Lyophilised material is stable for extended periods when kept dry and cold, and suppliers typically recommend storage well below freezing. Once dissolved, the peptide is handled at refrigeration temperatures and used within a short period, because peptide bonds and the acetylated terminus can be affected by repeated freeze-thaw cycles, proteases, or extreme pH. Bacteriostatic water and saline are both described as solvents, although preservatives can interfere with some analytical workflows. Reconstituted solutions are inspected for particulates before use.
Sports authorities classify the peptide as a prohibited substance, and it appears on the World Anti-Doping Agency list under peptide hormones, growth factors, and related substances. Racing jurisdictions for horses and dogs have issued separate restrictions, and several national bodies treat it as a controlled or prescription-only item. As a research chemical it is sold without a therapeutic indication, and labels usually state that the product is not for human or veterinary use. Regulatory treatment therefore varies by country.
Detection in biological matrices generally relies on liquid chromatography coupled with tandem mass spectrometry, because the peptide lacks a convenient ultraviolet chromophore beyond the amide backbone. Immunoassays have been described, but antibodies raised against the fragment can cross-react with the full-length protein or with unrelated peptides, so findings usually require confirmation by a second technique. Sample preparation typically involves protein precipitation followed by solid-phase extraction. Reported detection windows depend on dose, route, matrix, and instrument sensitivity.
Bromley is one of the major metropolitan centres identified in the London Plan. Bromley had one of the highest gross disposable household incomes (GDHI) in the UK, at £27,169 in 2018. Bromley was ranked fourth in Greater London by Retail Footprint in 2005, behind the West End, Croydon and Kingston upon Thames. Bromley competes with both Croydon and the Bluewater centre in Dartford as a shopping destination.
Potassium sulfate (US) or potassium sulphate (UK), also called sulphate of potash (SOP), arcanite, or archaically potash of sulfur, is the inorganic compound with formula K2SO4, a white water-soluble solid. It is commonly used in fertilizers, providing both potassium and sulfur.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
On February 26, 1997, Staley and the other members of Alice in Chains attended the Grammy Awards after the song "Again" was nominated for Best Hard Rock Performance. In April of that same year, Staley purchased a 1,500 sq ft (140 m2), three-bedroom condominium in Seattle's University District via the "John LaRusta" trust, an alias used by Staley. Toby Wright, the producer of Alice in Chains' third album, set up a home recording system for him there. In 1998, amid rumors that Staley rarely left his apartment, had contracted gangrene, and had lost the ability to ingest food and was living on a diet of Ensure, Jerry Cantrell told Kerrang! that the members of Alice in Chains regularly hung out at Staley's house. On June 22, 1998, Staley made a phone call to radio program Rockline and gave a rare interview while Cantrell was promoting his first solo album, Boggy Depot. Staley called the show to talk to Cantrell and stated that he had loved the album. In October 1998, Staley re-emerged to record two tracks with Alice in Chains, "Get Born Again" and "Died", which were released on the Music Bank box set in 1999. Additional reports of Staley's deteriorating condition persisted in the midst of the sessions. Dirt producer Dave Jerden—originally chosen by the band for the production—said, "Staley weighed 80 pounds...and was white as a ghost." Studio engineer Elan Trujillo commented that Layne "definitely didn't look like how he used to look" and noticed Staley had, in addition to no teeth, atrophy in his legs.
Sources: en.wikipedia.org
== Etymology == The etymology of the common name "emu" is uncertain, but is thought to have come from an Arabic word for large bird that was later used by Portuguese explorers to describe the related cassowary in Australia and New Guinea. Another theory is that it comes from the word "ema", which is used in Portuguese to denote a large bird akin to an ostrich or crane. In Victoria, some terms for the emu were Barrimal in the Dja Dja Wurrung language, myoure in Gunai, and courn in Jardwadjali. The birds were known as murawung or birabayin to the local Eora and Darug inhabitants of the Sydney basin.
Sterilization is an important factor to consider during the fermentation of foods. Failing to completely remove any microbes from equipment and storing vessels may result in the multiplication of harmful organisms within the ferment, potentially increasing the risks of food borne illnesses such as botulism. However, botulism in vegetable ferments is only possible when not properly canned. The production of off smells and discoloration may be indications that harmful bacteria may have been introduced to the food. Alaska has witnessed a steady increase of cases of botulism since 1985. It has more cases of botulism than any other state in the United States of America. This is caused by the traditional Alaska Native practice of allowing animal products such as whole fish, fish heads, walrus, sea lion, and whale flippers, beaver tails, seal oil, and birds, to ferment for an extended period of time before being consumed. The risk is exacerbated when a plastic container is used for this purpose instead of the old-fashioned, traditional method, a grass-lined hole, as the Clostridium botulinum bacteria thrive in the anaerobic conditions created by the air-tight enclosure in plastic. Research has found that fermented food contains a carcinogenic by-product, ethyl carbamate (urethane). "A 2009 review of the existing studies conducted across Asia concluded that regularly eating pickled vegetables roughly doubles a person's risk for esophageal squamous cell carcinoma."
Conditions in the predominant agricultural sector kept deteriorating between 1929 and 1939, which resulted in rural unrest and a progressive radicalization of the Polish peasant movement that became increasingly inclined toward militant anti-state activities. It was firmly repressed by the authorities. According to Norman Davies, the failures of the Sanation government (combined with the objective economic realities) caused a radicalization of the Polish masses by the end of the 1930s, but he warns against drawing parallels with the incomparably more oppressive Nazi Germany or the Stalinist Soviet Union.
Whatever may be the tendencies and inclinations, it must be emphasized that if America seeks to dictate to other powers their actions and policies, it can do so only by maintaining a preponderance of power manifested in an extension of political and economic control … But in the light of all recent history he who would consciously, deliberately elect that course is either unread, incapable of deductions from his reading or perverse. In self-contradiction, Peffer ended the article recommending for the postwar period a preponderance of power of offensive kind backed by total national effort: The United States will need "a larger permanent military establishment," alliances with other powers having common interests and an alliance with Great Britain that would be not only defensive but also "outright, unconditional offensive." It means full-scale power politics and to it "must be accommodated and sometimes subordinated everything else in the nation’s life." On 24 September 1946, Truman's Special Counsel Clark M. Clifford submitted a report "American Relations with the Soviet Union…" advocating a preponderant power:
== Interactions == Monoamine oxidase inhibitors (MAO inhibitors) are another class of drugs blocking catecholamine degradation. Therefore, their combination with opicapone can result in increased catecholamine concentrations in the body and corresponding adverse effects. Combining the antiparkinson MAO inhibitors selegiline or rasagiline with opicapone is considered safe. Potentially, there are also interactions with drugs being metabolised by COMT (for example isoprenaline, epinephrine, dopamine, or dobutamine), tricyclic antidepressants and antidepressants of the norepinephrine reuptake inhibitor type. Possible pharmacokinetic interactions are with substrates of the liver enzyme CYP2C8, such as repaglinide, and the transporter protein SLCO1B1, such as simvastatin.
Sources: en.wikipedia.org
TB-500 is a name used for a short synthetic peptide fragment taken from the actin-binding region of thymosin beta-4. Material sold under this label is usually a lyophilized powder supplied for laboratory research rather than a licensed medicine. The commonly cited sequence is LKKTETQ.
The parent protein contains forty-three amino acids, while the fragment carries only a short motif from one region. The fragment can interact with actin in vitro, but it does not include the rest of the protein structure. Whether the shorter molecule behaves the same way in living systems is not settled.
Published controlled human studies are scarce, and most activity reports come from cell culture or animal models. Reviews often describe the evidence base as limited and methodologically uneven. Open questions include the relationship between route, dose, and measured outcomes.
It is a synthetic peptide based on a short sequence near the start of thymosin beta-4. It is supplied as a research chemical rather than as a licensed pharmaceutical product.